Cody

Problem 79. DNA N-Gram Distribution

Solution 341253

Submitted on 28 Oct 2013 by Chris Cleveland
This solution is locked. To view this solution, you need to provide a solution of the same size or smaller.
Solve This Problem View on Solution Map

Test Suite

Test Status Code Input and Output
1   Pass
%% s = 'AACTGAACG'; n = 3; hifreq_correct = 'AAC'; assert(isequal(nGramFrequency(s,n),hifreq_correct))

[Warning: Last element of input column does not match first element of input row. Column wins anti-diagonal conflict.] [> In hankel at 28 In nGramFrequency at 2 In verifyCode>evaluateCode at 231 In verifyCode at 40 In fevalJSON at 14]

2   Pass
%% s = 'dynamic routing service'; n = 2; hifreq_correct = 'ic'; assert(isequal(nGramFrequency(s,n),hifreq_correct))

[Warning: Last element of input column does not match first element of input row. Column wins anti-diagonal conflict.] [> In hankel at 28 In nGramFrequency at 2 In verifyCode>evaluateCode at 231 In verifyCode at 40 In fevalJSON at 14]

3   Pass
%% s = 'Your veracity is exceeded by your sagacity.'; n = 5; hifreq_correct = 'acity'; assert(isequal(nGramFrequency(s,n),hifreq_correct))

[Warning: Last element of input column does not match first element of input row. Column wins anti-diagonal conflict.] [> In hankel at 28 In nGramFrequency at 2 In verifyCode>evaluateCode at 231 In verifyCode at 40 In fevalJSON at 14]

4   Pass
%% s = 'AGCGAAGGAAGGATCACATTTCTCAGGACAAAGGCATTTCACTAATGGTT'; n = 3; hifreq_correct = 'AGG'; assert(isequal(nGramFrequency(s,n),hifreq_correct))

[Warning: Last element of input column does not match first element of input row. Column wins anti-diagonal conflict.] [> In hankel at 28 In nGramFrequency at 2 In verifyCode>evaluateCode at 231 In verifyCode at 40 In fevalJSON at 14]

5   Pass
%% s = 'In short, in matters vegetable, animal, and mineral, I am the very model of a modern Major-General.'; n = 2; hifreq_correct = 'er'; assert(isequal(nGramFrequency(s,n),hifreq_correct))

[Warning: Last element of input column does not match first element of input row. Column wins anti-diagonal conflict.] [> In hankel at 28 In nGramFrequency at 2 In verifyCode>evaluateCode at 231 In verifyCode at 40 In fevalJSON at 14]

Suggested Problems

More from this Author95

Community Treasure Hunt

Find the treasures in MATLAB Central and discover how the community can help you!

Start Hunting!