Clever usage of the Hankel matrix. I don't automatically think of the Hankel for this application, but it really works well. Thanks - I've learned something
Test | Status | Code Input and Output |
---|---|---|
1 | Pass |
%%
s = 'AACTGAACG';
n = 3;
hifreq_correct = 'AAC';
assert(isequal(nGramFrequency(s,n),hifreq_correct))
|
2 | Pass |
%%
s = 'dynamic routing service';
n = 2;
hifreq_correct = 'ic';
assert(isequal(nGramFrequency(s,n),hifreq_correct))
|
3 | Pass |
%%
s = 'Your veracity is exceeded by your sagacity.';
n = 5;
hifreq_correct = 'acity';
assert(isequal(nGramFrequency(s,n),hifreq_correct))
|
4 | Pass |
%%
s = 'AGCGAAGGAAGGATCACATTTCTCAGGACAAAGGCATTTCACTAATGGTT';
n = 3;
hifreq_correct = 'AGG';
assert(isequal(nGramFrequency(s,n),hifreq_correct))
|
5 | Pass |
%%
s = 'In short, in matters vegetable, animal, and mineral, I am the very model of a modern Major-General.';
n = 2;
hifreq_correct = 'er';
assert(isequal(nGramFrequency(s,n),hifreq_correct))
|
Make the vector [1 2 3 4 5 6 7 8 9 10]
35554 Solvers
732 Solvers
What is the distance from point P(x,y) to the line Ax + By + C = 0?
277 Solvers
367 Solvers
485 Solvers
Find the treasures in MATLAB Central and discover how the community can help you!
Start Hunting!