Community Profile

photo

Ahmad


UST

16 total contributions since 2015

Contact

Ahmad's Badges

  • Thankful Level 1

View details...

Contributions in
View by

Question


Help me understand code to draw the nullclines
The code can be found here: <https://www.math.uwaterloo.ca/~bingalls/MMSB/Code/matlab/symmetric_network.m>

casi 4 años ago | 0 answers | 0

0

answers

Question


Matlab index in range yet I get out of range
I'm trying to extract the model parameters using: clc clear all data = xlsread('cancer_train.xlsx'); X = data(...

alrededor de 4 años ago | 1 answer | 0

1

answer

Question


How to plot this function in matlab?
x=e^((y-b)/a)

más de 4 años ago | 2 answers | 0

2

answers

Question


Function handle is giving wrong results!
This code is clearly giving wrong results: clc;clear all a0 = 2; a1 = 2; y = [1 1.4 2.3]; x = [1 2 3]; f = @...

más de 4 años ago | 2 answers | 0

2

answers

Question


How to draw a log function?
I love function handles in matlab, I can do this for example: f = @(x,a,b) a*(x.^b); plot(x,f(x,a,b)); This is so use...

más de 4 años ago | 3 answers | 0

3

answers

Question


Multiple conditions for while loop.
while (Ea0 >= 0.01)&&(Ea0 >= 0.01)||(Sr >= 10^-4) This loop keeps on going even though the first part (Ea0 >= 0.01)&&(...

más de 4 años ago | 1 answer | 0

1

answer

Question


How to change the name of the program, and GUI.fig
My friend did the GUI part of this program, I'd appreciate if you told me how to change the name, and a quick overview of it and...

casi 6 años ago | 1 answer | 0

1

answer

Question


Formating and tweaking output
I need to achieve three more things with my program: 1. Make dots appear slowly to correspond to the time it takes for an op...

casi 6 años ago | 0 answers | 0

0

answers

Answered
Take input and use it in a function
Thank you so much

casi 6 años ago | 0

Question


Take input and use it in a function
I''m trying to write a program that can analyze protein relationship. I'm trying to make the user input the accession number of ...

casi 6 años ago | 2 answers | 0

2

answers

Question


Please debug this code for me
I'm trying to make a program based on this tutorial: http://www.mathworks.com/help/bioinfo/examples/using-scoring-matrices-to...

casi 6 años ago | 0 answers | 0

0

answers

Question


Please fix this code
protein1=input('Please input GenPept code of the first protein: ', 's'); protein2=input('Please input GenPept code of the s...

casi 6 años ago | 2 answers | 0

2

answers

Question


Plz explain this code to me!
Hello, I'm trying to understand a program that identifies recognition sites for restriction enzymes of a DNA sequence, and outpu...

casi 6 años ago | 0 answers | 0

0

answers

Answered
Why doesn't this matlab code work?!
thank u so much for offering help, i understand what a cell array is now, but i don't understand thsis syntax "y{1}", and sorry ...

casi 6 años ago | 0

Answered
Why doesn't this matlab code work?!
couldn't understand what it says, plus i'm trying to add this line too, can u fix it: cut_position= strfind(s,y) + x -2; i...

casi 6 años ago | 0

Question


Why doesn't this matlab code work?!
s={'CCCAGCTCCCGAATTCCCCAGCTA'}; rec={'AG^CT'}; x=strfind(rec,'^'); y=rec; y(x)=[] I get: Error using su...

casi 6 años ago | 4 answers | 0

4

answers