Binary to DNA sequence encoding - matlab
3 visualizaciones (últimos 30 días)
Mostrar comentarios más antiguos
Meghashree G
el 20 de Sept. de 2015
Comentada: Image Analyst
el 5 de Feb. de 2021
I am implementing DNA encryption algorithm.
For that, I have a vector containing binary values such as:
01100011 01110010 01111001 01110000 01110100 01101111.
Now, these values should be mapped to DNA sequence. How do I do that in MATLAB?
2 comentarios
Star Strider
el 20 de Sept. de 2015
DNA has four bases (two complementary sets, A-T and C-G) and you have a binary sequence ...
Respuesta aceptada
Image Analyst
el 20 de Sept. de 2015
Perhaps this:
% Assign sample data.
binaryArray = [0,1,1,0,0,0,1,1, 0,1,1,1,0,0,1,0, 0,1,1,1,1,0,0,1, 0,1,1,1,0,0,0,0, 0,1,1,1,0,1,0,0, 0,1,1,0,1,1,1,1];
% Define base letters to choose from.
bases = 'ATGC';
for k = 1 : 2 : length(binaryArray)
% Convert these two digits into a number 1 - 4.
index = 2 * binaryArray(k) + binaryArray(k+1) + 1;
% Use that index to assign a letter to our result.
result((k+1)/2) = bases(index);
end
% Display in command window:
result
It shows:
result =
TGACTCAGTCGTTCAATCTATGCC
12 comentarios
Image Analyst
el 5 de Feb. de 2021
Shiva, I'm not sure who you're asking, but personally I don't have any to give you.
Más respuestas (0)
Ver también
Categorías
Más información sobre Cell Arrays en Help Center y File Exchange.
Community Treasure Hunt
Find the treasures in MATLAB Central and discover how the community can help you!
Start Hunting!