Window length Selection size for DNA sequence?
Mostrar comentarios más antiguos
i have a DNA sequence like
ATTCGATTGCCCAATTGGCTTATCCAATACTGGGA and wanna read the DNA sequcnce on a window size 5 ,10 and 15 so how to do this?? please drop a code
Respuestas (0)
Categorías
Más información sobre Genomics and Next Generation Sequencing en Centro de ayuda y File Exchange.
el 28 de En. de 2019
Community Treasure Hunt
Find the treasures in MATLAB Central and discover how the community can help you!
Start Hunting!
Translated by 
