Window length Selection size for DNA sequence?
1 visualización (últimos 30 días)
Mostrar comentarios más antiguos
i have a DNA sequence like
ATTCGATTGCCCAATTGGCTTATCCAATACTGGGA and wanna read the DNA sequcnce on a window size 5 ,10 and 15 so how to do this?? please drop a code
0 comentarios
Respuestas (0)
Ver también
Categorías
Más información sobre Genomics and Next Generation Sequencing en Help Center y File Exchange.
Community Treasure Hunt
Find the treasures in MATLAB Central and discover how the community can help you!
Start Hunting!