Borrar filtros
Borrar filtros

Window length Selection size for DNA sequence?

2 visualizaciones (últimos 30 días)
Siyab Khan
Siyab Khan el 28 de En. de 2019
i have a DNA sequence like
ATTCGATTGCCCAATTGGCTTATCCAATACTGGGA and wanna read the DNA sequcnce on a window size 5 ,10 and 15 so how to do this?? please drop a code

Iniciar sesión para responder a esta pregunta.

Respuestas (0)

Categorías

Más información sobre Genomics and Next Generation Sequencing en Help Center y File Exchange.

Etiquetas

Productos


Versión

R2014a

Community Treasure Hunt

Find the treasures in MATLAB Central and discover how the community can help you!

Start Hunting!

Translated by